EST 504138 is a singleton


Sequence

>504138 (1 EST) Length=318 TATATATATATATTTTAATNACTTGCATAATTTTGCATGTATATTGGGTCAAGAGACAATGGTGCTTTGGCCTGANATGC GAAAGAGGATTTGCCATAAGGTCATTATCAATAAATGGTATATTAAGAAAATTTGGTAATATAGGTAAAGGAGGTGTTAG AGGTATATNATTCACATTATTAAAATTTAACATGTTATTAAAATGATTTNCATTATTATTTTGTGGAAGTGGTATAAAAT TAGGATTGTTTATATTATGATGACTTGATGGATTATATTTNTNTNTATTAGTAGAATAATTATTCATATAATNNTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504138: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041381399999N975020608M3gmbPfHB3.1, G. Roman Reddy


Date: 0:49:18 on Thu 23 Nov 117.