EST 504139 is a singleton


Sequence

>504139 (1 EST) Length=350 TTTACCTATATATCTTTTGTTGGCCTGTTTTATTTCTCGGAAATGTATTATGACCCGCTGGTTGCACTTGTGAATATATT ACCCGTAGAAAAGTTAAGCGATGAGAATAGTAAAAAAAAATCAAGGTGGGAAAGAAATGCAACTAACAATATTATAGAAA ATAAAGTAGTTGTATCGAACAAATGGGGGTCTGAAGATTATAAACCTTATCTTCCATTACCTTTTGTTGATTTCCCACCA GGTTTAACTCCGGCGCAATTAGATCAATTTTTGAGAGACAGCGATATGATGAATTAACAAAAAAATTAAATAAAGGGGAT TTAGATTATGTAGTCCNGACATTCGACCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504139: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041391400000N975030608M7gmbPfHB3.1, G. Roman Reddy


Date: 4:41:21 on Sat 25 Nov 117.