EST 504142 is a singleton


Sequence

>504142 (1 EST) Length=290 TGATAATAATGATAATAATGAATTATCAGGTGAAGGCCGTTTATCATCAAGTGGTATGTACAAAACAGAAGAATACTTAA ATGAAATTAAAAAAGATATTGTTCGTTGTATATGTGAAAAAAAAAATTATAATTTTATTAATGAAAAACAAGANAAAATA AATAATGAAATATTTTATAAAGTTTTCGAACAATATCCTTACAGTTTTTTCTCAAAATCAGTCAAAAATTATAAAATAAT ATTAANTGAAAACGNNGNAGGATCAGAGTATCATGGCTAACTATGCTCAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504142: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041421400003N975060610M7gmbPfHB3.1, G. Roman Reddy


Date: 9:48:28 on Thu 23 Nov 117.