EST 504146 is a singleton


Sequence

>504146 (1 EST) Length=219 ACATTAATTTATTTGCGAATTAACATGTACGAGGTATTGTAAATAAAACGACGGTTGGTATAATAGCCAAAAGAACTAAT GAAATATATGAACCTATTTTTAAATGGTTATACCATCTAGGTTTGTTATCCATATGTTCATTGTATAATATTCCGAGGGA TATGCCTAATAAGTTAACATTTTGTGGTAAAAAAAAAGGAATATATATATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504146: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041461400007N975100614M3gmbPfHB3.1, G. Roman Reddy


Date: 11:14:2 on Sun 19 Nov 117.