EST 504148 is a singleton


Sequence

>504148 (1 EST) Length=212 TATATATATATGTTACATGTTTTTCTTTTTTTATTTTATTAAAAAATTAAAGGCTTACCTTTAAATGAGTCTTCTAATAT TATCTGTAATAATATTAACACAAAGGAAAATATTTACATATAACCATATTTTTTTTTTTTTTTTTTTTTTTTTTGGGTTT GTTACTAAATATATATATAANTNAATATTATATTTTNATTTANCCCTATCCN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504148: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041481400009N975120615M3gmbPfHB3.1, G. Roman Reddy


Date: 7:39:57 on Sat 18 Nov 117.