EST 504149 is a singleton


Sequence

>504149 (1 EST) Length=192 TATATATATATATAGGTCTGTATTAATATTTTCGTTTATATAAAAATATACAGGATAAGTCTACTCTAGAAAGAAAAACT TATCTCCTTGATTCTTCAAATTATGAAATAGATGACGGTATATATATAAAGAAAAAAAANAAAAAAAAATACACAANCAC ACATATATATATATATATATATATNTCNNNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504149: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041491400010N975130615M7gmbPfHB3.1, G. Roman Reddy


Date: 14:51:2 on Sun 19 Nov 117.