EST 504152 is a singleton


Sequence

>504152 (1 EST) Length=289 ATATATATTTAAATTTCCATTTTTTTTTTANTTTTTTTTTTTCATTTTGCAGATTACTCAAAATTATTTGGTACACTTGG GNATATATATTTAAGNTTTCAAGGNAGNATAAAAAAACATAACGTAGGATATTTNAGTATTGAAAGAAGGTATGAAAGAA AAACATAAACTATTACGTTCATAATATAGTTAATAGTAAGTTTTAACACAAATAAATCTGATAATTATTAATATAAAGTT AATAATAACNATATAAAANCTACATGGAAAAAACANTTCANAAAAANCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504152: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041521400013N975160617M3gmbPfHB3.1, G. Roman Reddy


Date: 4:43:22 on Sat 25 Nov 117.