EST 504155 is a singleton


Sequence

>504155 (1 EST) Length=273 TTAATATTATAAGTATAATTACAATTATATTCACACAGAAATATTTACACAACAACCAATTAAAATATGTTCCTTGACTC ATTTTTATATTTCAACATATCACAATTTTATATATCTCTATAACANTCTTCCTACTTTAAATTGGTATTACTCANTAATT TCACATTGAATGTAGAATTACGTGTATTACAATATAACATATTTTAACAATAATTTTTTAGATTAACTTTTTTNTTTTNN TTTNTAATTATATGTATAATATTANGAGAATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504155: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041551400016N975190619M7gmbPfHB3.1, G. Roman Reddy


Date: 6:21:33 on Fri 24 Nov 117.