EST 504156 is a singleton


Sequence

>504156 (1 EST) Length=141 TATTTATTTATTTATTTACATTTTATTTTTTGTAATTTCAAAAAGAGCACATCTTTAAGCTAGGAAAAAGGAAAATATAA AATATCACACAAAACAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANNTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504156: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041561400017N975200620M3gmbPfHB3.1, G. Roman Reddy


Date: 22:2:3 on Sat 18 Nov 117.