EST 504157 is a singleton


Sequence

>504157 (1 EST) Length=261 TTTTAATTATAATATTCTCATATAATTTGTTATTTCTTGTAGAATATATTTTTATTTTAATACAATGCTACAAAAGTGCG ATCAATTTTATGATGCCCATTCAAAAAAAAAGTGTCCGAATTAAAAAGAAGAATGAATCTAGAGTTAATAAGAAGTAGGG AAAATTAAAATGAAAAGAGTAAAATACACGNAACAAGTTATAGTATTCTACAACTTTTAGGATATAAGANAATAGTTACA GAANATNATTATAATANTATN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504157: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041571400018N975210620M7gmbPfHB3.1, G. Roman Reddy


Date: 1:51:42 on Sat 18 Nov 117.