EST 504160 is a singleton


Sequence

>504160 (1 EST) Length=218 CTTTAAAGGGCAAATTATTATTTAAGCACACATGTTTATTTTTTTTTTATTGAATAGAGGGTATTATATCTGCATTTATT TATAATCACAAATGTTATTATTAGTGTCCTTTTGTTTATGCGAATTTATATGTAAACATAAGTGATACAAAAAAAAAAAA AGAAAAAAAAAAAAAATTGCACATATGTATATGTCCATATATATATCTCTCNCNCNNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504160: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041601400021N975240622M7gmbPfHB3.1, G. Roman Reddy


Date: 13:10:17 on Sun 19 Nov 117.