EST 504172 is a singleton


Sequence

>504172 (1 EST) Length=350 ATAATGTGCATACTATGTTACGTAACAAATTATATTTAAAAAAAAAAAAAGAATGTAGTAATTATAATACTTCTAATGAT GGNCATGGGCATGGGACATTTATTGCTGGTATAATAGCAGGGAACTCTCCGAAAGGAAAAAAAGGAATTAAAGGTATTAG TAAGAAAGCAAAATTAATTATATGTAAAGCTTTAANTAATANTANTGCTGGTTATATTAGCGATATATTAGANTGTTTTA ATTTCTGTNCTAAAAAAAANGCAAGANTAATAACTGCTAGTTTTGCTAGTACTNCACATTACCCATCTTTAATTTCAGGC TTTAANAGGATTNCAAGGTTAANGGTNTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504172: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041721400033N973240631M3gmbPfHB3.1, G. Roman Reddy


Date: 2:18:29 on Thu 23 Nov 117.