EST 504192 is a singleton


Sequence

>504192 (1 EST) Length=197 TCATTTTTAAACTCCAAACTAGTCCTAAAACACTTATATATATATATAACACCATCCTTACATCCTACAGATAATAGTGT ATAATTCTAATTTATATTATCTTGACCCATACACAAATATGTNATAGGTATATNTCCTTTAAGCGTTATTTCATAAACCG GTTGTAAACCTTTNCCTAGATCTNAATTATATNTNNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504192: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041921400053N973440120M3gmbPfHB3.1, G. Roman Reddy


Date: 10:52:32 on Tue 21 Nov 117.