EST 504194 is a singleton


Sequence

>504194 (1 EST) Length=264 ATGTGATACACAATCTATTGCTAATATTTTATGGAGCTTATCAATATTAAATGTTTATTCAAGAAATGTTTTTGAAGATG GTTTATATGAATGTAATAAAAGATTTATTAAATGTGGGAAAAAAAAAAATACAACTAAAGTAAAAANTTTCATATCGCAA TTACATCAATCACAATTATATCAAGCTGCCTTTCCTNATTGTCTTTATTTATTAAATAATCAAAANCATATAANTAAGTT ATTAAAANNTAAAGANAATTATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504194: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041941400055N973460124M7gmbPfHB3.1, G. Roman Reddy


Date: 19:47:40 on Mon 20 Nov 117.