EST 504197 is a singleton


Sequence

>504197 (1 EST) Length=127 CAACTCATTCATTTTTTTTNATTTACTAAATATTTTATATAATGAGATAACCAAAATGTAGACACAGATATATTTAATAA TTAAAATAAATGCACTTGGGAATTATATATAAATATATATATATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504197: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041971400058N973490180M3gmbPfHB3.1, G. Roman Reddy


Date: 21:12:50 on Sun 19 Nov 117.