EST 504201 is a singleton


Sequence

>504201 (1 EST) Length=350 TTAGACCATCATGCTTTCTCTTCTTTTTAATATTATCATTAGTAACAAATATTAAATAATTAACAGCATCATACATTTGC CATATATTTTCTAATACTTCATTTTTATTATTTATTCTTCTTAGAAGTATAGGATTTAGAACGGTTACCAATCCAGTTGT TATAAAANTATATATATCATAATAATTATAAGGACCATATACATTATTATCAACACCATTCATCCATTTCAGTTGCCAAT GTATGTCTACGTTTTCTTTATATTCTTCANGTTTCTTACATAATGCTTCGAATTCGCGTTTTGTTAAAAAGTACACATTT NTATATTCATTTTGTTAANCTTTNGTGNTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504201: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042011400062N973530228M7gmbPfHB3.1, G. Roman Reddy


Date: 4:40:0 on Sat 25 Nov 117.