EST 504205 is a singleton


Sequence

>504205 (1 EST) Length=239 AAATGTATATAAAAATTGTCAAAAATATTAAACGATATCACAACATATTTCATTATAGAAAGGAATGTGTAGCTACAGAA TCTTTAATAAAAAATACTTATTTAACTAAAGAATATTATGACAAAAATAAGAAGNAAAAAATAGACTTATTTGATTTTGT ACCACCAGAAAATTTCGTATCCTCATATTTTGAAAAGCTGGATAAGTGTTATTCTAATCCAAGATCTATATTANGGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504205: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042051400066N973570234M7gmbPfHB3.1, G. Roman Reddy


Date: 11:19:19 on Sun 19 Nov 117.