EST 504206 is a singleton


Sequence

>504206 (1 EST) Length=133 CATAATGAAGATATTGTTGGTACAAATAAATCAGNAACTAATTTATTAATACAAGAGAAATTATCAAGCTATAATATTAA TGTCAGGGAAAAAAAAAAAAATAAANCTAAATGGANTAAAGNTAAANTNGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504206: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042061400067N973580254M7gmbPfHB3.1, G. Roman Reddy


Date: 4:25:13 on Fri 24 Nov 117.