EST 504213 is a singleton


Sequence

>504213 (1 EST) Length=127 GTATGTAAATAATACCTTTTTTTTTGGCCTTTCTCTTGATATTATTAAATATGTACATGTAATGTATTTGTAAATTTAAT GAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANTTTTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504213: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042131400074N973650379M7gmbPfHB3.1, G. Roman Reddy


Date: 18:42:56 on Sat 18 Nov 117.