EST 504223 is a singleton


Sequence

>504223 (1 EST) Length=200 ATATATTTATATTTACTTATTAATTTTATGAATTCGACATGGAATTCAAGATATTAATTAAAAGTTATAGAAGAAAAGAN AAAAANAAGAAATATGTTTTTTTTTTTTTTTTTGAGCAAATTTGTGTAACATGAAATGTAAGAGTATATATATTTATTNT GNGTAACTTGATGATGTGTATCCAGAATAGAGGNTNTNTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504223: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042231400084N973750419M7gmbPfHB3.1, G. Roman Reddy


Date: 21:1:55 on Wed 22 Nov 117.