EST 504226 is a singleton


Sequence

>504226 (1 EST) Length=214 TGCTATATCATATATTATGCTGTGTTTAATTTTGTAATATTTTTTATAACTTACCTATTATGTGAATTGTGAACATCTAA CAATTAGCATATGATATGAATTATTGAGGACTATAAAATATATAAAAAAAATATATATATACACATATTGTTTTTTTTTT TTTTTTTTTTTTTTTTTATCCTTTAAAATNTGAAAANATTTCAGNCCAACGNNG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504226: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042261400087N973780423M7gmbPfHB3.1, G. Roman Reddy


Date: 14:15:33 on Fri 17 Nov 117.