EST 504228 is a singleton


Sequence

>504228 (1 EST) Length=186 TATATAATGATTTTTTTTTTTTTTTTTCTCCTTATTTTGCAGGAGTACCATTTTTTAAAAATACAATTATTATTTTTTTT TTTTTCTTATAGAAACAACAAAATTGAAAATACTTTTTAAGTAATCGAAACGTAATTTTTAATTTTATNATATTATTTAT TNATATACTATATAATCNCTNATNCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504228: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042281400089N973800453M3gmbPfHB3.1, G. Roman Reddy


Date: 14:29:54 on Tue 21 Nov 117.