EST 504229 is a singleton


Sequence

>504229 (1 EST) Length=330 TATAAGGATCAGTACAAAAAAATTAATCTCTTTAATAATAAGTGTATTAACGATATTCCTGATCAAAACATAAAANCATT CTGTTCCAATTTTATTCCACCATATTCTTATATATATGTTNAAAATAAGCTGTTTTACATTTCCCCTAGCTCTATAAATA TTCTATATGCCCCCACAAAGTAAGACAACAGTAAAGTAAAANTCATATAAAGTTAATAAAAAAAATAATTGTATAAATAT ATTTACGGGTAGATAATCTATATATTCTGTAATATGCGCTTAAATAGATCCTTCNNTGNATATTCANGCAAAAGGANAAA AAAAACAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504229: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042291400090N973810463M3gmbPfHB3.1, G. Roman Reddy


Date: 4:8:39 on Thu 23 Nov 117.