EST 504233 is a singleton


Sequence

>504233 (1 EST) Length=263 TTTATTTTTTTTTTAATATTTATATATTTATAAAAAATGGAAAGCAAAATCTGTGACCCCATTGGGCTCGATAAAAATAA GTTTCGTAAAGTAGAAGAGGAAAATNAGGAGAATAGTAAAATAGTAGAAAATGGGCAAATGACATATAATGACGATTTAG AAATGTTCACAACAATACAACTTAATCAAGNNATAGNTATACGTAAGACCCCTTTNCCATTACATATGGTAAATCANAAG ANTGGTATACCTTTNTGTNCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504233: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042331400094N973850501M7gmbPfHB3.1, G. Roman Reddy


Date: 9:59:43 on Fri 24 Nov 117.