EST 504236 is a singleton


Sequence

>504236 (1 EST) Length=138 GAAACATATATATGTTCATATTTATATAATGCAAATNACTTTTTTCCTTTTTTTTTTCGTCCACGATTTCGTTGAGGCAT TCTCCTTTTNGAAAAACATTATCATNATATAAGTNTTCAAATGAATTGTTATTNTTNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504236: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042361400097N973880551M7gmbPfHB3.1, G. Roman Reddy


Date: 12:56:52 on Sat 18 Nov 117.