EST 504238 is a singleton


Sequence

>504238 (1 EST) Length=205 ATTTTTTTAAGCTGTACTACGAGCTTCCAATCTTCCATTGTNAACTCGCTTCTAAAATATTCTTTCAGAACATCTATACT TTCTCTNGTAATTTNACTATAAATNTNTNGTGTTGAATCAAAATGTTTACCATATGTAACATGTGGTTCCCCACAAATNT NAATACATACTTCATCTCCTTTNCTGGCTTTATCGAAATTNTTNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504238: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042381400099N973900553M3gmbPfHB3.1, G. Roman Reddy


Date: 18:55:40 on Thu 23 Nov 117.