EST 504243 is a singleton


Sequence

>504243 (1 EST) Length=238 CTTTTTTATATTGCTCAAAAATGATTCAAGGAGGAAAAAAACATCTTTATAAAAATATTATATTNGATTTGTAATATTAA TATTATTTTGTTTTTTAAAGAATATGTGTTAAAAACTTAAATGAAATTTATAAAAAGGACATCAAAAAATTAGTATCGCA TTTTTNCATTGTTTCCATATTTTTNATGTATTATGCTTTTCATAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504243: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042431400104N973950562M7gmbPfHB3.1, G. Roman Reddy


Date: 16:1:30 on Tue 21 Nov 117.