EST 504245 is a singleton


Sequence

>504245 (1 EST) Length=253 TTNCGTCACATTTATATAAGGATGGTTCTTGGTTTTCCTTTCCTTTTTTTTGATAATATGGTTTTAATTTAATAAGGCGT TTAACTTTTTTTTCATACTTTNAATTATTTCGTCATCTTCATTATATATACCAGTTTGTATTAGTCTACTAATTTCACTC TTTAAATTTNCAATAACTTTATNATNATTTTNTTNGTCGTATATTTTTTTTGAAACAATGTTAGATTTATCCTTATCCAT AACTAATNTGNNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504245: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042451400106N973970575M3gmbPfHB3.1, G. Roman Reddy


Date: 14:22:53 on Mon 20 Nov 117.