EST 504248 is a singleton


Sequence

>504248 (1 EST) Length=350 ACATAGNTATATATATATATATAATAGTATATATNATTAANTGAGTGTGTAGGTGTACATATAGCAATACCTACTTTATA TCACACATTTNANTCANTTTTTTAAGCTACCTAATTAGCTTTTNTTTCATTATAGGATTATAAGAAAAATAAGTCTTGCC TTTCTCATTCTTCAATAATTTTAATGAATGANTTGCACAAAAAGTTGTACCGGCATGGGATTCTGAACCAGGAAGATTTG AAAATCCTCCATCTATATTAAAACAATTTATTATCCAATGTATACATTTATTATTATTTATATTATTAACATAGGTATTN CTTTCCTTAAATAATTTATTTAATAGGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504248: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042481400109N974000578M7gmbPfHB3.1, G. Roman Reddy


Date: 21:53:23 on Sat 18 Nov 117.