EST 504253 is a singleton


Sequence

>504253 (1 EST) Length=265 TATTACCACGTTCAATCCAAAGCGTTCAGCTCTTTTCCTTTTATTCTCTTCCTCCATTTTATGTGTTACTATACTAAATC TACATAAAAAAAAAAAAAAAATAAAATAACAAGCATATTAAAACTATTTACAAATATATTACAACTATATAATTAAAAAA AAAAAAAAAAAAAAAAAAAGGCCCCCCTATTTNTTTNTTTTTTTTCCCTTTNGGCTCTNGTTTCAGGGGCATCANCGGTT TTTCCACCNCCTTTTAANTTTTAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504253: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042531400114N974050634M7gmbPfHB3.1, G. Roman Reddy


Date: 6:5:15 on Wed 22 Nov 117.