EST 504257 is a singleton


Sequence

>504257 (1 EST) Length=302 AAAAAAATGGAAATATAGGATATAATGAAAATCCCTTTGAAGAACCATCAGTATCACTAAATGACATAATAGAAAAAGAT AATAATAATTATAACATGGATACTAATAATAATATAACAAATAATCTTAATAGATATATGAAAACATTTAAGCAAAATAA AAACCATCCATATAATATATCTAATAAGACTAATTCAAATATATATGCGTCTACTCACGNNTCAAATACTAAAGATGATA TTCTTGTTAATCAATTACAAAATAATATATTANGCAACGGAAAAGATAAAGACGGNAANNNG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504257: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042571400118N974090636M7gmbPfHB3.1, G. Roman Reddy


Date: 6:48:15 on Sat 25 Nov 117.