EST 504259 is a singleton


Sequence

>504259 (1 EST) Length=249 TTTATTTATTTATATAAGTATGTGTTTATTGTATATATTTGTAAAAACATTCATTTCGTTTTATTTCATTTCATTTCATT TCATATAATTTNAATTTTTTTGTTGTGTAGTTGGATTTAACGGTTCAGGGAAAAGCAATATTTTATTAGCTATCGAATTT ATATTAAGTGATGTGTGTGAGTACAAGCAAATATATTTCCATGANGGTATTGGGAATGCAGTTCGCAATTGTNATGTGGA AATANTTNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504259: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042591400120N974110637M7gmbPfHB3.1, G. Roman Reddy


Date: 2:48:8 on Tue 21 Nov 117.