EST 504260 is a singleton


Sequence

>504260 (1 EST) Length=234 ATTTTTAATATATTTTTAATTTTTAATATTTTTTGTGTGTATGCCAATATNATGCTTCGCATAGGCAAGAATAAAGCAAA AGGGAGCCTTTNCATTAAAAAGTGTTATTATACAAATAATAGTAAGGGATGGCTTAGGGAATACGTATATACAAAGTATC GTATAAGTTTGCCAAACATTGAAAACGTAAAANATGATGATATATATNNCNCATGTCCTAGTAGGGNTGACTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504260: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042601400121N974120649M3gmbPfHB3.1, G. Roman Reddy


Date: 19:20:40 on Wed 22 Nov 117.