EST 504263 is a singleton


Sequence

>504263 (1 EST) Length=338 TAGNGTGCGACGTCGGCTCACTCGGGACAATTAATTTTACCAGACACATTAAAATTGTTACCTCTATTTACCTCGTGTTT ATTAAAACATAATGTTGTGAAGAAGGATGCTTTACATGATTTAAAGGTGTACAACTTAATAAAATTGTTGTCGATGCCAA TAATATCTNCTCTGGNGGGTGTATATCCAGTGATGTATTTAATTTATATGAAAGGTCGACATAATGAAATCNGATTATAT GGATGTAGATGACGAGAATTTCCTCCCAAGAGCGACACCGACAAGTGCTGAAANCAATATATTCTNGCGGNATTTATTTA TNGGTTCNGCTCACCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504263: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042631400124N974150650M7gmbPfHB3.1, G. Roman Reddy


Date: 17:54:19 on Mon 20 Nov 117.