EST 504271 is a singleton


Sequence

>504271 (1 EST) Length=265 CTAAAATATAATGCAAATAAAATNGAAGAAGATTTTCANTGTGTACAGTCTTTGGATTCCTACTGTACTGACTGTGCTTG TTATTATTGTTGTTGTCCATCTTCTNCCTGTCCATTAGAAAACGATGACACGATATTACAAACAAATGAAGATAAAAATG GGAATTATNAGGATAGCTGTGAAAATATAAAAAATGAAATAAATCATTTGGAAAAGGAAANGCCAACAAAANATAATGAA GAAAGATGANGNCCGNTGAAGAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504271: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042711400132N974230695M3gmbPfHB3.1, G. Roman Reddy


Date: 19:19:12 on Thu 23 Nov 117.