EST 504272 is a singleton


Sequence

>504272 (1 EST) Length=222 CTAATTNTTTTTCTAAAGANTATCCTCTCTTTTTATTATGCGAAGATTTTNTACAATTATCTTGATTCGTCATTTCCTTT GCTGATATATTTGAAACATATTTACTTTCACTCCCTTCTCTATTATGTAATTCATTTCTATTATGAAATTCATCTGATCT TTTCAAATCATTTAATGTATCATTTTNATTTATTNCATTAGATATATCATTTTNNTTNATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504272: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042721400133N974240695M7gmbPfHB3.1, G. Roman Reddy


Date: 4:34:56 on Thu 23 Nov 117.