EST 504275 is a singleton


Sequence

>504275 (1 EST) Length=200 TTTATTTATTTATTTATATAATTAAAATATGGAGAAGAAGATAAAAAGAAAAGATGATAGCAAAAGTATTAAACCATCGA ATAAGTATGTNAATATNCCTAATTCTTTNATATTTAATTTAATGCATGTNTGCATCCATTTAAATAATCACAGTTTTTTT TTNCCNTATGTATTGAATAAGAGANGAAAAAANTAAAAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504275: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042751400136N974270734M3gmbPfHB3.1, G. Roman Reddy


Date: 1:30:7 on Sun 19 Nov 117.