EST 504280 is a singleton


Sequence

>504280 (1 EST) Length=125 TTAAATAAACATATATGCTTAAAATTAGCTTCACATTGTTTTATTTATTTTNAAATTAATTTTTTAAGATGAAATATTAT AACTTTTNANTGTTTTTNTTTAAAATACAAAAAAAAAAAAANANT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504280: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042801400141N974320736M7gmbPfHB3.1, G. Roman Reddy


Date: 3:49:31 on Sun 19 Nov 117.