EST 504284 is a singleton


Sequence

>504284 (1 EST) Length=196 TATTTTATTTTATTTTGTTTTATTTTTATTTTTTTTTTTTTTTTTTTTTTAGGAAGGAGTGAGTGACGAACATATTGGCT CACTTGAACGGAACGAAATCACTGCCCTCATAAATNCCCTATACTACTTTGCAGATTCTATATTAATAATAAACAAGTAA AAAGAAAAAAAAAAAAAAAAAAAAAANTTTCCNCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504284: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042841400145N974360767M7gmbPfHB3.1, G. Roman Reddy


Date: 21:56:54 on Fri 17 Nov 117.