EST 504287 is a singleton


Sequence

>504287 (1 EST) Length=138 ATCTTTTTATTTTATATATATACATATATAGCAATGCCTATATCATTAAATAGTTTTAAAGAAGAAGAGCTTATCTCCTT AGAAAAAGGGGATNTGGNGCGTGTTTTATATAAAGGAAGTGATATTGAGNTNATTNAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504287: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042871400148N974390770M3gmbPfHB3.1, G. Roman Reddy


Date: 4:37:57 on Sat 25 Nov 117.