EST 504308 is a singleton


Sequence

>504308 (1 EST) Length=350 CTAATATAACATATTCATTATTTATATATATATTACTTNCTGTATTCATTAATAAACTATGTATTAGATGGGATGGATAA AGCCTTCTATTATNTTCATCTATATTCAATTTTAATATTACATCATCATTAATATTATGACTACTTAACAAACTATGAGC ATTTATTATTATATTTCCACTTGAATTATATAAATTTCTATATATCACATCTCCTATATTCCAAGATATATATAAATATG AATTTATAGGTATTGTTATTAGAATAATTATNCCCATGCATGTAACAAAAAAACTCACGCCCACAAGTTATATNACTNTN CGGCAAATATATTCCTCNCTATTNACATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504308: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043081400169N974450849M7gmbPfHB3.1, G. Roman Reddy


Date: 21:39:34 on Fri 17 Nov 117.