EST 504311 is a singleton


Sequence

>504311 (1 EST) Length=212 TTATGCGTGTGTGTGTGTCTATGTGTGTACTATTTATTTCTTATGCTTATCTCTTTCTATGTCTGNACATCTACATNNNG GCGGAACAAATCATTTCCTTATTTTTACTTTTTAATATACAATAAATTTTACAAAAATGAGAAAAGATAAGAAAAAATAT ATGACACTCCAATANCTTTAATTACATAGGATTACAATNATGNGGNATTNAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504311: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043111400172N974480873M3gmbPfHB3.1, G. Roman Reddy


Date: 20:4:37 on Sat 18 Nov 117.