EST 504360 is a singleton


Sequence

>504360 (1 EST) Length=271 AATAATAAATAGTATTATATATATCCATATGTATTTCTTTATCATATGATTTTCTTTGTTCTTCGTCATCATTACTTGTA AATTTACTTCTTAAAACATCTATAACATCTTGCCCTGTATTGCTTTTATTCTTTTTAATGGATTTTATCCAGTCATCGAA ATAAGGTAAAATAATAGCACTTTTATAAATTTAATTCCTTTTTATATATTTGGTAAAATCATAAAATACATCTTTTAGAA ATTTGCTAACATCATTACAATTATATATACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504360: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043601674544N981780181C3czapPFDd2.1, Debopam Chakrabarti


Date: 10:31:20 on Tue 21 Nov 117.