EST 504367 is a singleton


Sequence

>504367 (1 EST) Length=98 GGCACGAGTGTTGATCCAAAAACGAAAAATAACAAAAAAAAGAAAATTAAAATATAAGGAATAATATATATAATATAATA ATATATTAATTTNNCGNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504367: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043671674551N981850208C3czapPFDd2.1, Debopam Chakrabarti


Date: 1:20:21 on Tue 21 Nov 117.