EST 504384 is a singleton


Sequence

>504384 (1 EST) Length=279 GGCACGAGGTCTTAGAAAAAGAAAAAATTAACAATTCTTTAGATACTCCTATAGCTAAATNATATGCGGTTGCATTAGGA CTGTTATTTTTATGTTCAAGAGAAAAATGTGAAGCTACCTTATCCGCTTTAGAAATNATTAAGCATCCTATTTCAAAATA TATGATAGCAACAGTAGAAGGTATGGCTTTTGCTGGATCTAATGATGTTTTAAAAGTTCAAAAAATGTTACAAGTATTAG TTGAAAAAAGAGGTGATNAAAAANATAATTCCGNTAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504384: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043841674568N982020284C3czapPFDd2.1, Debopam Chakrabarti


Date: 10:33:42 on Sat 18 Nov 117.