EST 504395 is a singleton


Sequence

>504395 (1 EST) Length=105 ACCACAAGAACCAGTCGCACCACAAGCAACAGTCACAACACAAGAAACAGTCGCACCACAAGAAACAGTCACAACACAAG AACCAGTAACAACACAAGAACCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504395: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043951674579N975450364C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:51:37 on Wed 22 Nov 117.