EST 504396 is a singleton


Sequence

>504396 (1 EST) Length=103 AGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTTTTTTCGTCTACTTTGGTGCTTTTATTCGATGGTGTGGACACGA TTGCATTACGTATTATTCCCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504396: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043961674580N975460368C3czapPFDd2.1, Debopam Chakrabarti


Date: 10:35:16 on Tue 21 Nov 117.