EST 504402 is a singleton


Sequence

>504402 (1 EST) Length=122 GGTTTTTTTTTTTTTTTTTTCCAAATAACATATATATATAAAAATTATTCTTCTCTTTATATAATATCAATTAAGCTTAT TTCTTCTTTGGTAATTTCACTTTTCTTATATTTTATTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504402: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044021674586N975520443C3czapPFDd2.1, Debopam Chakrabarti


Date: 20:41:16 on Thu 23 Nov 117.