EST 504404 is a singleton


Sequence

>504404 (1 EST) Length=77 GGAAATAAATACAATTTAAAAAATATTAATCATCGTGTAATATTCTAATTTTGTGTATACATGTATATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504404: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044041674588N975540453C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:33:3 on Fri 17 Nov 117.