EST 504410 is a singleton


Sequence

>504410 (1 EST) Length=146 AAAAAAGGTTCATAAATTTTTTGACAGTTTACAACTTTAAATAAAATAAATAAATGAGATTCATATTTTTTTTTATATTT TTTTAATTTCCATATTAATTGATTTATACATGGTTTATTAGAATTTGTCAGTAATATATTTCCTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504410: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044101674594N975600499C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:5:1 on Fri 24 Nov 117.